Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14257H9
Clone ID IST14257H9
Vector VICTR74
Project tigm

Sequence tag IST14257H9BBF1
Sequence
TTCCAAAGGTCTGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI25459 UNI36605 UNI36606 UNI36607

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 109457319..109457386 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 49297611..49297678 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62517183..62517250 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54729107..54729174 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 73414679..73414746 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80855659..80855726 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042292 (Mkl1) NM_153049 MKL (megakaryoblastic leukemia)/myocardin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2384495]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61253276..61253343 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68255105..68255172 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34728090..34728157 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143867171..143867238 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045078 (Rnf216) NP_542128 ring finger protein 216 Gene [Source:MGI Symbol;Acc:MGI:1344349]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 145253966..145254033 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137961106..137961173 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040298 (Btbd16) NP_001074507 BTB (POZ) domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:3045247]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87672788..87672855 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107259108..107259175 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 150567943..150568010 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000081702 (BX005465.14)  

 
Come back to gene ENSMUSG00000081702


For any suggestions or comments, please send an email to unitrap@crg.es