Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14479B6
Clone ID IST14479B6
Vector VICTR74
Project tigm

Sequence tag IST14479B6HMR1
Sequence
TTCTCATCTTCTCTCCCAGCTCTCTCCGCTATGGAAGTAATTCTTTCTTTATCTTTTATCCGTTGTTTGTTTGTTTTCTA
GACAGAATTTCTGTGTGTGGCCTTGGCTGTCCTGGAACTTGCTCTATAGATCANGCTAGCCTTGAACTCANAGACCCCCA
CCTACCTCTGCCTCCCCAGTTGAGTTCTGGCATTAAAGGTGTGCGCCACCACCTCCCANCTGTANGCCTGAATTTCTTTA
CCCTTATCTTTCACACCTCTTTCTGAGTTTTTATTTGACATTGTCTGATGTGAGGACCTGAGGTGCGGANAGATGTTATA
ATCTTGGTGTCTTACTTTTTCTCTCTTTACNGACATGGGGTATTCTCNAGGAANANGANGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126806393..126806772 357
 
EST/CDNA Est Name
  BX524706.1 - CN720654.1


Sequence tag IST14479B6HMF1
Sequence
GAGAACTTAGAAGACTTAAAAGCTATTGCAAGCTCACTCGCTCTCTGGTCTGGAAGACGGTGCCACGCGCCACACCATGC
TCCTAGCCGCTTTCCCCTGACTGATTGGCACCTACTTTCTTCCCCCTCACGACCCAGCACAAATTATGCAGCCATCGAGC
CTGGGCTCCCATTCTTTCAGAGCCACTTATTAGCTGAGTGACCTGGGTAGTTAATAGCCAGTTTTCTCACTCGTAAATGA
GGATAATGAGAGGATAGCTTAGAGACTTAAATGGGTTAATATATAATATAAAGTCTTTANAATGGCAAGAACTANGAAGG
AGCAGGAAATANAGAGGGCTCAGCTCCTGTCCANGANNACTCTCTTCCCTCNGCATCTTCCGTGGCAGANAGACACNNNG
NAN
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126806002..126806397 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]


Sequence tag IST14479B6BBF1
Sequence
GAGAACTTAGAAGACTTAAAAGCTATTGCAAGCTCACTCGCTCTCTGGTCTGGAAGACGGTGCCACGCGCCACACCATGC
TCCTAGCCGCTTTCCCCTGACTGATTGGCACCTACTTTCTTCCCCCTCACGACCCAGCACAAATTATGCAGCCATCGAGC
CTGGGCTCCCATTCTTTCAGAGCCACTTATTAGCTGAGTGACCTGGGTAGTTAATAGCCAGTTTTCTCACTCGTAAATGA
GGATAATGAGAGGATAGCTTAGAGACTTAAATGGGTTAATATATAATATAAAGTCTTTAGAATGGCAAGAACTAGGAAGG
AGCAGGAAATAGAGAGGGCTCANCTCCTGTCCNGGAAGACTCTCTTCCCTCTGCATCTTCCGTGGCANANAGACACN
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126806002..126806397 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es