Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST432180
Clone ID OST432180
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST432180
Sequence
TGAGGAAACAATGAAGGGAGACAGCAGNATCTGAATGAAGAAGAGGGTGCCAGCGGGTATGAGGAGTGCATTATCGTTAA
TGGGAACTTCAGTGACCAGTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCTGCACAGAGCCAG
TCTGCACACCAGAGACCAGAGGCCGNAGGTCAAGCTCCCGGCTGTCTAAGAGGGAGGTCTNCAGCCTTCTGAATTACACG
CAGGACATGACAGGAGATGGAGACAGAGATGATGAAGTAGATGATGGGAATGGCTCTGATATTCTAATGCCAAAGCTNAC
CCGTGAGACCAAGGACACCAGGACGCGCTCTGAAAGCCCGGNTGTCCGAACCCGACATANCAATGGGACCTCCAGCTTGG
AGAGGCGAAGAGCCTCCCCCAGAATCACCCGAGGTCGGCAGGGCCGCCACCATGTGCAGGAGTACCCTGTGGAGTTTCCG
GCTACCANGGTTGGTCCCATCTCTGATCTCAAGATCTGCTTCATTCACTCCCCACAACACAACATTGTC
Sequence Type mRNA
Unitrap ID UNI18009

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153487159..153491172 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027478 (Dnmt3b) NM_001003960 DNA methyltransferase 3B Gene [Source:MGI (curated);Acc:Dnmt3b-003]

 
Come back to gene ENSMUSG00000027478


For any suggestions or comments, please send an email to unitrap@crg.es