Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14771E2
Clone ID IST14771E2
Vector VICTR76
Project tigm

Sequence tag IST14771E2BBF1
Sequence
ATCTCTAGTTCAGGGTCAGCCTGGGCTACACAGGGAGTTCTAGGCAAACCTGGCCTACACAGTGTATCCTGCTGTGTTGG
CTAGTGTTTATGTCAACTTGATACAGCTAGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81067827..81067938 112
NO GENE  


Sequence tag IST14771E2HMF2
Sequence
ATCTCTAGTTCAGGGTCAGCCTGGGCTACACAGGGAGTTCTAGGCAAACCTGGCCTACACAGTGTATCCTGCTGTGTTGG
CTAGTGTTTATGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81067842..81067938 97
NO GENE  


Sequence tag IST14771E2HMR1
Sequence
TTATCNTCTTGCTTCTGCCTCCTAAGTGCTGGGTTATAGACTTATGTTACCACATATATGTCTGATAAATTTTATTTTTT
TAAATGAATGAAGTTGATGCCCATTGTTTAAAATGAACAGTTTCTCCTTTATGGAAGCGCCAGTTTATCTAAGATTAAAA
TATATGTGAGAATACTCCTTTTAGGTCACTTACTGTGATAAATACATTTTCTATATTAGGTATGTTGTACAAANCACTCT
TTANCTTTTTCATTTCTCTAANAATTGTGTTAATTATCTTATTTGTATAGTCTTACACTATGCTGCTTTTATAGTTGGGC
AAATGAGGATGNNNAANNTN
Sequence Type genomic DNA
Unitrap ID UNI30536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81067937..81068265 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es