Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793C6
Clone ID IST14793C6
Vector VICTR76
Project tigm

Sequence tag IST14793C6HMF1
Sequence
GTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGTGTTCGGCACCAC
CAAAGTTTTTGTTATTGTTTTTCTGGTTTGCTTTTAAAGACAAGAGTTTCTCTGTGCTGCCCTANAACTTGTTCCATAGA
CCAGGCTGGCCTTGAACCACAAAGATCCANCTGCCTTCTGGGATCAAAGCCATGTGCCNNCCCTGCCNNNCTTGTTTTTA
TGTTGGGATTTCACCATCCNNNGCTGGNTACACATTTGN
Sequence Type genomic DNA
Unitrap ID UNI30588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109016127..109016404 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001827 (Folr1) NM_008034 folate receptor 1 (adult) Gene [Source:MGI (curated);Acc:Folr1-004]


Sequence tag IST14793C6BBF1
Sequence
NNNTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGTGTTCGGCACC
ACCAAAGTTTTTGTTATTGTTTTTCTGGTTTGCTTTTAAAGACAAGAGTTTCTCTGTGCTGCCCTAGAACTTGTTCCATA
GACCAGGCTGGCCTTGAACCACAAAGATCCAGCTGCCTTCTGGGATCAAAGCCATGTGCCACCCCTGCCCAACTTGTTTT
TATGTTGGGATTTCACCATCCCAGGCTGGTTACACATTTGGTATGAAATTAAAAGTGACCTTGCATTTCTAATCCTCCTG
TCCCTAAATTCTGAGAATTCNCTACCNACTGANGTATATCTCCNGTCCCAGATACCANGGTCTTTTGGGTTTGTTTCTTN
CCNTNANTNNANTCTAAAANANTCANANNATCTCNGN
Sequence Type genomic DNA
Unitrap ID UNI30588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109015973..109016403 397
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001827 (Folr1) NM_008034 folate receptor 1 (adult) Gene [Source:MGI (curated);Acc:Folr1-004]


Sequence tag IST14793C6HMR1
Sequence
NNCAAAGTGAGTTCCAGGACAGCCNGGGCTATACAGAGAAACCCTGTT
Sequence Type genomic DNA
Unitrap ID UNI1464 UNI2886 UNI12788 UNI36613

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4856820..4856865 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11075724..11075769 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22854766..22854811 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051355 (Commd1) NM_144514 COMM domain containing 1 Gene [Source:MGI (curated);Acc:Commd1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 58041251..58041296 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035472 (Slc25a21) NM_172577 solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 Gene [Source:MGI Symbol;Acc:MGI:2445059]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 28298093..28298138 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32639423..32639468 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014496 (Ankrd28) NM_001024604 ankyrin repeat domain 28 Gene [Source:MGI Symbol;Acc:MGI:2145661]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5354037..5354082 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13774655..13774700 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28966829..28966874 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 55991257..55991302 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 43722462..43722507 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91577159..91577204 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87808209..87808254 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 13510543..13510588 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 31406248..31406293 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 20458847..20458892 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 47019172..47019217 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72504045..72504090 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7454635..7454680 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7115308..7115353 44
NO GENE  

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es