Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12032D11
Clone ID IST12032D11
Vector VICTR76
Project tigm

Sequence tag IST12032D11BBF1
Sequence
CTTGATGTTTGAAGGATGGCTGCGGTGGCCCATGCCTGGCATCCCCAGCGCTCGGGTGACCGAAGCAGGCAAATTCTAGG
ACAATTTAGGGAGACAAGGGGAAGTCCTGTCTCAAAGGCAAAAAAAGCGGTACTACTGTGTTATGTAATTTCGTTGGCGA
GCGGTAAGGATTTCCGGAGGTTAAAGCACCTCCCGTAGGTGCTCTTCAAGAATGCAGGTCTCCGTCCATTCATTANGCTA
CTTCCGTCATTTGGGATGTGATANCCCCAAGTGTGCATGAAGTGTTACCTANTTTTATCGCGTCTGCCTTTTTTTTNTN
Sequence Type genomic DNA
Unitrap ID UNI625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93833197..93833512 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039456 (Morc3) NP_001038994 microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]


Sequence tag IST12032D11HMF1
Sequence
CTTGATGTTTGAAGGATGGCTGCGGTGGCCCATGCCTGGCATCCCCAGCGCTCGGGTGACCGAAGCAGGCAAATTCTAGG
ACAATTTAGGGAGACAAGGGGAAGTCCTGTCTCAAAGGCAAAAAAAGCGGTACTACTGTGTTATGTAATTTCGTTGGCGA
GCGGTAAGGATTTCCGGAGGTTAAAGCACCTCCCGTAGGTGCTCTTCAAGAATGCAGGTCTCCGTCCATTCATTAGGCTA
CTTCCGTCATTTGGGATGTGATAGCCCCAAGTGTGCATGAAGTGTTACCTAGTTTTATCGCGTCTGCCTTTTTTTTNTTN
Sequence Type genomic DNA
Unitrap ID UNI625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93833197..93833515 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039456 (Morc3) NP_001038994 microrchidia 3 Gene [Source:MGI Symbol;Acc:MGI:2136841]

 
Come back to gene ENSMUSG00000039456


For any suggestions or comments, please send an email to unitrap@crg.es