Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14781D5
Clone ID IST14781D5
Vector VICTR76
Project tigm

Sequence tag IST14781D5HMR1
Sequence
AGGCGTGCATATGTGACTCTGGAAGAAATAAAGTTGAATCGTACTGACTCTTTGGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114786811..114786869 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]


Sequence tag IST14781D5HMF1
Sequence
NNANACANACACAGACAACTGGAAGGCAAAAGGTCTCATAGGTTTTTCAAATTACCATGATAAAAATAAGGCATCACTCC
AATGGCAAGTGCAATTTGAATATTCTGCCTTCCCCTAGATTCACTGAAGAAACCCAGTCTCCACAGCCACGTTTAGCTGA
GACAAGAAGGAAACTCTTGCACCGAGATGCCTGGTACGGAGACCCACTAGTCCTCCACCCCTCGCTCCTGGATCTAAATC
TCTGCACTTTAAATGCTGAGAACAGGGAAGGTTTCACCTCCAGCCTAGTTTAGACACAGCAGTCTAAAACCAGTAGGGGT
TAAACAATATGCAAATGACTTTTTAGCATATGCAAACCCATCAAATCTTTCAATAAATGGTNTTTNAAGACACTAANGAA
GGGTGGCTGAAGAACTGGACTTCTGAAAAGATGTAGATTCNNGCCACGTTTGCCATTTCTGACTNTGGCAGANTACCTNN
GNTNNAAAAAAGANANNNAGAAAANAACTGTGCNNGGCNNCNNCNTNNTTTNNNANNTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114786295..114786808 474
 
EST/CDNA Est Name
  BE651412.1

 
Come back to gene BE651412.1


For any suggestions or comments, please send an email to unitrap@crg.es