Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14337B1
Clone ID IST14337B1
Vector VICTR74
Project tigm

Sequence tag IST14337B1HMF1
Sequence
GTGTGCTCTTCTCCTGAGCCACAGACTCTGTCTTCTATTTTTTGTTTTGATTTATTTATTTATTATTTATTTTTATTTTG
AGACAGGGTCCGAGTTAGTTACTCGGGCTGGCTTTGGAATACTCTATGATCCAGGCAGGCCTTTTAGCTTGTGATTCTTT
CCTGCTTCCGCTCTCAAATAGCTGTGCTAGCTACTGTATGCTGGATACAGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71020459..71020671 213
 
EST/CDNA Est Name
  W70832.1 - BE861264.1 - W54597.1


Sequence tag IST14337B1HMR1
Sequence
CACACTAAATTCAAGCTCCGGGCATTTNATGAGTGCACACACACAGTCTCTAGTTCAGAAGGTAAATGTGTCTATCGGTG
ATAGCTGGGGTGTCACAGTTGCCCGCTGGGAAGTCAGT
Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71020346..71020463 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es