Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12513A9
Clone ID IST12513A9
Vector VICTR76
Project tigm

Sequence tag IST12513A9HMF1
Sequence
TAANNACACTGTAGTTGTCTTCAGATACACCAGANNANGNCATCAGATCTCATTACGGGTGGTTGTGAGCCACCATGTGG
TTGCTGGGATTTGAACATCGGACCTTCGGAAGAGCNNTCNGGTGTTCTTACCCACTGAGCCATCTCACCNNCCCCCGTTA
TCCATTTTTAAATGTCTTTCANANTTGGCTTGNNNGCTGATTGANAATTCAAGCCCCTGAATCAAAAACTGANCGTGGTG
GTACACGCCTTTAATCCCAGCACTTGGAAGGCAGANACAGGCANATNTNTGTNACTCTACACNGTGAACCAAGACAGCCN
NGGCTATNNTCCTGTNANACCCTGTGAANTGTGTGACTCNNNGTNNGCTACTGTGTGACNTTCNGTGGTTNGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12513A9BBF1
Sequence
TAAGTACACTGTAGTTGTCTTCAGATACACCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI1126 UNI12283 UNI25758 UNI36624 UNI36625 UNI36626 UNI36627 UNI36628 UNI36629

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133891210..133891259 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93647351..93647400 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005897 (Nr2c1) NM_011629 nuclear receptor subfamily 2, group C, member 1 Gene [Source:MGI (curated);Acc:Nr2c1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77203383..77203432 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72146776..72146825 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048118 (Arid4a) NM_001081195 AT rich interactive domain 4A (RBP1-like) Gene [Source:MGI (curated);Acc:Arid4a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17863460..17863509 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28271022..28271071 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040651 (D14Abb1e) NP_083221 Uncharacterized protein C3orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q69ZR9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9099934..9099983 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039704 (Lmbrd2) NM_177178 LMBR1 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444173]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17524974..17525023 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022761 (Lztr1) NM_025808 leucine-zipper-like transcriptional regulator, 1 Gene [Source:MGI (curated);Acc:Lztr1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35132142..35132191 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 84961978..84962027 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21898085..21898134 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153516830..153516879 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 31115537..31115586 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34915614..34915663 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 102289222..102289271 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122370547..122370596 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135057790..135057839 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030801 (Myst1) NM_026370 MYST histone acetyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1915023]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73103586..73103635 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21085227..21085276 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98865982..98866031 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034160 (Ogt) NM_139144 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) Gene [Source:MGI (curated);Acc:Ogt-001]

 
Come back to gene ENSMUSG00000034160


For any suggestions or comments, please send an email to unitrap@crg.es