Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12102F8
Clone ID IST12102F8
Vector VICTR76
Project tigm

Sequence tag IST12102F8BBF1
Sequence
CCCACAACTGCTGTGGAACACAGCGAGCAAGCGCCCTACGGTGGAATGGGGATCGCCCTGTCTTCTGACCGCTCCACTCC
CAGAGTAGGTAGTTGGTAATTGAATTAGCAGAGCTGGCATTCACAACATTCTCTTGGTATCCCATCTCAAAGGGCGTGTG
AATTCAGAGAATTCAGAAGGGCCCAGCAGCTAAGTCTCAGGCCCAGTCATGTTTACCCACTTGCCGTCAGCTGTGCTTAG
GTAACGTGATACATAAAAGTGGCCCAGGGAAATGACAGGGAGCAGAATGTCGGCTGACAGGGAAACAGGAGTTAACAGGA
AACACATGGTCTTGACACAAATGAACCTGCGCTGCTTCACCCGTCAGCTCTGGGCTCGTTTCAAGTCAACTTCCCCCAAN
GGCTGCATTGAGGGAGANTCCNAGCANGGCTCCTGANTGGTGCAGANTTAGTTCAAGTTTCCGCTTACCTGTCTCTCGGA
CTATGCACCAGANGCGTGGANTN
Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118771907..118772406 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]


Sequence tag IST12102F8HMF1
Sequence
CCCACAACTGCTGTGGAACACAGCGAGCAAGCGCCCTACGGTGGAATGGGGGATCGCCCTGTCTTCTGACCGCTCCACTC
CCAGAGTAGGTAGTTGGTAATTGAATTAGCAGAGCTGGCATTCACAACATTCTCTTGGTATCCCATCTCAAAGGGCGTGT
GAATTCAGAGAATTCAGAAGGGCCCAGCAGCTAAGTCTCAGGCCCAGTCATGTTTACCCACTTGCCGTCAGCTGTGCTTA
GGTAACGTGATACATAAAAGTGGCCCAGGGAAATGACAGGGAGCAGAATGTCGGCTGACAGGGAAACAGGAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI25019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 118771907..118772222 313
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039115 (Itga9) NM_133721 integrin alpha 9 Gene [Source:MGI Symbol;Acc:MGI:104756]

 
Come back to gene ENSMUSG00000039115


For any suggestions or comments, please send an email to unitrap@crg.es