Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15001G8
Clone ID IST15001G8
Vector VICTR78
Project tigm

Sequence tag IST15001G8BBF1
Sequence
TGCACAATCTCGCACATACCCGTGCTACAAAAAGGCCTACGATTATACAAAGTCAGAGGACTATGAAAAGAATCCAAGGC
TACCCTGAAGACCCCAAGAAAATGACGTCCCAAGGCCACAGAGATGTACCTGCCCACCACTTGCCCTCCGGACCCANCGC
TGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76363527..76363689 161
 
EST/CDNA Est Name
  CD803828.1


Sequence tag IST15001G8HMR1
Sequence
GTGCAGATACGTTGTTTTGTGTCTTCAAGCATTTTCAGTTCTGTTTAAGTAGAGACAGGGTTGAGGTTTCCTGGGTTTTC
TTCCTTCCACATTANCCTCTCTCTCTCTCTCTCTCTCTCTN
Sequence Type genomic DNA
Unitrap ID UNI27121

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76363412..76363531 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es