Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14665A6
Clone ID IST14665A6
Vector VICTR74
Project tigm

Sequence tag IST14665A6HMF1
Sequence
ACCTCTATCATCTTGTCTTATTTACATCCCTTCCTTTTAAGCACTGGGCATTTCTTTTCTAATTTCCCCATCTCTTTCTC
CATTCCTACAGTGAATACCACATCCACACAGTCAGTAAAAGACTACATTGTCCTTTTACACCCAAAGGACAGTTTGGTCC
AATGGATAGTTCTGTCAAGGCTGTTGCTTTTAGTAAATATCTATCTCAGAACTGGTGGTGTTTCCCTGCAGTGTAGCATT
TGCCTAGCATGCATGATGCCCTAGATTCCAGTCCCAAGACTGTCAGAAAGAAAGAAGGAAAGCCGGGCGTGGTGGCNCAC
GCCTTTAATCCCAGCACTCGGGAGGCAGANGCAGAGGCAGAGGCAGGTGGATTTCTGAGTTCNAGGCCNGCCTGGTCTAC
AAAGTGAGTTCCAGGACAGCCNGAGCTATACAGANAAACCCTGTCTCNNNCTNCCCCCCCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7586894..7587356 441
 
EST/CDNA Est Name
  AK008008.1


Sequence tag IST14665A6BBF1
Sequence
ACCTCTATCATCTTGTCTTATTTACATCCCTTCCTTTTAAGCACTGGGCATTTCTTTTCTAATTTCCCCATCTCTTTCTC
CATTCCTACAGTGAATACCACATCCACACAGTCAGTAAAAGACTACATTGTCCTTTTACACCCAAAGGACAGTTTGGTCC
AATGGATAGTTCTGTCAAGGCTGTTGCTTTTAGTAAATATCTATCTCAGAACTGGTGGTGTTTCCCTGCNNTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7586894..7587127 230
 
EST/CDNA Est Name
  X61816.1 - AW226948.1 - BB564674.1


Sequence tag IST14665A6HMR1
Sequence
GGTTATTTANNAAAATAAGCCTATTTTATTCCTTANCACCCTAAAAAATACACATGGAATCAAGCTATTTAGAAACTATA
AAGAAGGGGATGGANAGATGGCTCANTGGTTAAAAGCACTGGCTGCTCTTCCANAGGTCCTGAGTTCAATTCCCAGCATC
CACATGGTGGCTCACAGCCATCTATGAGGGATCTGGTGCCCTCTTCAGGCAGGCANATATATATGCANCANANCATTCAT
ACATTAAATTAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI12836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7586638..7586896 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es