Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10389G2
Clone ID IST10389G2
Vector VICTR76
Project tigm

Sequence tag IST10389G2HMF1
Sequence
AGCAGCCTTGGGTTCCCATAGTAACCAGTCCATCAATGCCCCCAGTGTCGAGATGGTGGCACCGCANAGGGGAAGAAATA
GTCTCATTGTCTCCCCTTTGGCCGCTTGGGCACAAACAAGCCGCACCCCGCAGGGCCCTGCAGTGCGCTGAGGTCCAGCC
AGATTTGCTGCCCTGCCGTGGTGTGCTACACATGTCCCCTCCTGAACTGGGCCAGGAAGGGACCATCACTGTCANTCTTG
GACCCTCATGGGGACTCTTAAATTTCTGCCACTGGAACGCCATCAA
Sequence Type genomic DNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73016219..73016493 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es