Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10340D11
Clone ID IST10340D11
Vector VICTR76
Project tigm

Sequence tag IST10340D11BBF1
Sequence
CTGTGAGGGATGGGCGCGAATTCCGGCTCCCGGTGGCTCGGTGGTGACCCGACGGCGAACGCCGGCCGGGCTTGGCCTGA
GGTGAGCTCCGTTGTTCTGGTCCCTCCAGCGGCGGGCAGCCGTTTCCCGCTTCGCACGCACGGAGAGAAGATTCCCGGCT
CGGGAGAAACCGCTGCTGGCAACGGGAGGCCCCGGAACGCGAGCGCCCCTGTTCTCGGTTGGTGTAAGCATCTCTTGCAA
GCCGCANATTTTCTGAGTGCTTGGAATTCGAGTTCCTCGCTATTTTCTTTCACTGATTTTGTTNACCGATCCAGGAATCT
TTATATCTATCTCCCCGTTTAAAGTATTCTCCCTTACCCCATCCGTCCCTTCAAAAAGAAAAAGAAAANNGGAAAAGGAT
TTTAAAAAAAGAGAGAGAGAGANATNNNTGGATGCTACAAGGACACAGCGTGGCAATCCTCCGANCTGCTGCAACCTNGA
GGGGACN
Sequence Type genomic DNA
Unitrap ID UNI31211

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120091968..120092453 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043993 (2900052L18Rik) RIKEN cDNA 2900052L18 gene Gene [Source:MGI Symbol;Acc:MGI:1924085]

 
Come back to gene ENSMUSG00000043993


For any suggestions or comments, please send an email to unitrap@crg.es