Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15068C3
Clone ID IST15068C3
Vector VICTR80
Project tigm

Sequence tag IST15068C3HMF2
Sequence
ATGTATGGATATATGTGTGTATGTACGTATGTACTTATGTATGTATGTATGTATGTATCTATCTATCTATCTATCTATCT
ATCTATCTATCTATCAATTTTTTTTAAAAAAANANAATCTATCTATCTATCTATCTATCAATTTTTTTTTAANAAANANA
AAAAGAAGTTACCGTGCACCTCNGCACTTANCANCCTTGGCACCCANTTANGAAAGTTATTTTTGGTTANCTATAACTAA
AAGGCTTTAAAAGGTCTCTGGGCACACACACNNNTTTTAATTGCNTATTTTTAAAANTNNNNGGCTCTTACAANGAAGGN
NGNTNNNNATTGGCTGNANTTANANGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15068C3BBF1
Sequence
GAACTTAAACTTTACTGAATAGGCTTTTCTGAACGTAACTCAACCACTTAATAATTATTAAATCCCATCAATTATTTAGA
AAAAGAAGGAACTGGACTCAGCATGCTCAAGAAGATTAGAATTATATGAGCACATATTTTTAAAAGTTAAATAGGGTTTG
ATCAAGATACTGTATAAAAATACAATGTATGTTTAAACTGTTAGAAGAGTAAACAAAAATATTATTTTTAAAAATCATGT
ATTTATGTAGTTAGGTCTATGTGATTTTTAAACATTACACATCAAGAACCAGAGGATATAGAGAAAAATGTTAATAATAA
AAATGTCATAGTCTTTTTAAGACTCAGATATTCTTTTTAAAGAGGGGGAAAAAATGGTGGGATTTGGGGGTTCTGAAAAA
TGGCTGCTCTTATGANTTANAAAGAAAGCTCAAACAGACTCTAGTGAGAAAAATGATTGAAAATTTAAAATTTTNNNTTN
NNANAATCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56023250..56023722 466
 
EST/CDNA Est Name
  BQ964692.1 - CB195826.1 - AW825329.1 - BU152607.1 - CB183479.2 - BY250269.1 - BQ877892.1 - BF166507.1 - BQ899759.1 - DV657922.1 - BG172805.1 - CJ092873.1 - BI695251.1 - BI697012.1 - BI158298.1 - BI663599.1 - CF897389.1 - BI656846.1 - CJ071598.1 - BI151367


Sequence tag IST15068C3HMR1
Sequence
TTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTANCAGTGTTCTCCTGTATTTCTTTAAGTGATTTAT
GAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCAAGGTCTAGGTTTTCGGGTGTGTTGGGG
TGCCCTGGGCTGGGCGAAGTGGGAGTGCTGGGTTCTGATGATGGTGAGTTGTCTTGGTTCCTGTTAGTAGGATTCCTACG
TTTACCTTTCGCCATCTGGTAATCTCTGGAGTTAGTAGTTATAGTTC
Sequence Type genomic DNA
Unitrap ID UNI32698 UNI33124

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 12657824..12658109 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 47974817..47975102 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 48535179..48535464 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 31370924..31371209 276
 
EST/CDNA Est Name
  BY299212.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 19156573..19156858 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021314 (Amph) NM_175007 amphiphysin Gene [Source:MGI Symbol;Acc:MGI:103574]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16341574..16341859 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16322607..16322892 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16398141..16398426 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14723038..14723323 276
 
EST/CDNA Est Name
  BY259575.1 - BY262740.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 7787030..7787315 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 11279511..11279796 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7498759..7499044 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12907902..12908187 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3041412..3041697 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 11962727..11963012 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 15556557..15556842 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 12167162..12167447 276
 
EST/CDNA Est Name
  CA533825.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23098799..23099084 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25409429..25409714 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036611 (Eepd1) NM_026189 endonuclease/exonuclease/phosphatase family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914734]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 391136..391421 276
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166420: 79362..79647 276
 
EST/CDNA Est Name
  CA585602.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9172369..9172654 276
NO GENE  

 
Come back to gene CA585602.1


For any suggestions or comments, please send an email to unitrap@crg.es