Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11170E7
Clone ID IST11170E7
Vector VICTR76
Project tigm

Sequence tag IST11170E7BBF1
Sequence
TAAGGATGGATCTAAAACATGAATTTAATTTAGTTTTTTAGTNAATTTAATCAGGACATGAGTCAACTTACCTACCAGCT
CGTCACACGAATTTACTAATATGCTTCTGCAGCGTTCTGTGGAGAAAACCTGTTTTTCCCTTTTCTAATAAGGTAGCTGT
TTTAGGATTAATCTATAAGCCNATAAGTAGATCCCTTTAAGATACTATAAAGCATTTATTAANCTCTTTGACATTNAAAT
ATTAAATTTTGAAAATNANGGTAAGACTTTAATAGTGTGCATGGGAATGCACTANATAGCATGCACGGGGATACAATTTC
TCTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACTTTTGAATNAATNACTAGTTGACNNA
NCATTNNANATACTTGGCTGNAAAGGGGCAGTGACTNATTGCACTTTTAATCNATTNTCTTAAGGAGCAGTTGTAACTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11170E7HMF2
Sequence
TAAGGATGGATCTAAAACATGAATTTAATTTAGTTTTTTANTCAATTTAATCAGGACATGAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI15390 UNI15587 UNI30811 UNI32041 UNI32321 UNI32725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11611608..11611674 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23578777..23578843 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9872943..9873009 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 79509430..79509496 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047454 (Gphn) NM_172952 gephyrin Gene [Source:MGI Symbol;Acc:MGI:109602]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8763262..8763328 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55706323..55706389 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38833428..38833494 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32509680..32509746 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024050 (Wiz) NM_212438 widely-interspaced zinc finger motifs Gene [Source:MGI Symbol;Acc:MGI:1332638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35315800..35315866 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88593660..88593726 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88520079..88520145 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 143433764..143433830 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 131623655..131623721 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056018 (1700008F21Rik) NP_083568 RIKEN cDNA 1700008F21 gene Gene [Source:MGI Symbol;Acc:MGI:1922703]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7497630..7497696 65
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27140587..27140653 65
NO GENE  

 
Come back to gene ENSMUSG00000056018


For any suggestions or comments, please send an email to unitrap@crg.es