Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14605D9
Clone ID IST14605D9
Vector VICTR74
Project tigm

Sequence tag IST14605D9HMF1
Sequence
CTAACGAGGAGAAAGACTAGGGACCCGGCTAGTTACCCGCATCTGAAAGCCATGGAACACACTCTGAAGGAGGAGCCAAG
TCCTTGTGTGGCTGTGGCTAAGCTCTACCCTCTCAGGCCCCTCTCACAACCCCATAGCCTGCCTGGCTCAACAGCTTTGG
GTTCTCTCACGATTCTAGGCTGTTGGTCCTTACTTCCTCTTCCTGGAAAGGTAGTTTGGCCTCCACTCAACCTGATCATA
CTTCCTTGACAACTGTAGCCCTTCANCACAACACCGGGATGGAACTCTTTCCCAAATGGGCTCCGCCCTCTTAATTCTTG
TGTGTGTAAATGCTTGCCCGCACATACATGTGTGCGGTGCTCGCAGGGGCCAGAAGANGGTGTCGGACTTCCTGGANCTT
GCCTTGAGCTGCAGGACTGGAGTCCTTGGAACCATACAAAACAAANGCCCTCAGCANGAGCAGANAGTGCTGGAAACTGC
TGANCCATCTCCCCAGCCCCCACCCGGATGTCATTTCCTGCCCACNTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30986240..30986768 513
 
EST/CDNA Est Name
  CB519151.1 - BU052765.1 - BI409029.1 - BY748418.1 - BY751933.1 - BG242630.1 - CD550220.1 - BE288421.1 - BY241837.1 - BY237845.1 - BB850099.1 - CJ186961.1 - BY237301.1 - BY289585.1 - BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407


Sequence tag IST14605D9HMR1
Sequence
TTAGTAGAACACTAAACTCCAGCCTGGACTAGGGAGATATCCCAGTGGTTGAGAGCACTTGCCATACGAACATAAGGACC
CGAGGTCATGCCCTCGGAGCCCATGTAGAAAGCCAAACATGGTTGTACAGGGTTAGGGTTAGTCC
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30986100..30986243 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es