Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10914E9
Clone ID IST10914E9
Vector VICTR76
Project tigm

Sequence tag IST10914E9HMF1
Sequence
TTGGACAGCCAGGGCTATACAGAGAAACCCTGTCTTGAAAAACCAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI16792 UNI32954 UNI36646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 62368111..62368170 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4717973..4718032 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45728497..45728556 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 38561145..38561204 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 13692548..13692607 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8497456..8497515 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4384989..4385048 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33383151..33383210 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 12084560..12084619 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38763952..38764011 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 57045232..57045291 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025083 (Afap1l2) NM_146102 actin filament associated protein 1-like 2 Gene [Source:MGI (curated);Acc:Afap1l2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76422222..76422281 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 37339764..37339823 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32048986..32049045 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21105754..21105813 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048520 (Fbxl13) NP_796050 F-box and leucine-rich repeat protein 13 Gene [Source:MGI (curated);Acc:Fbxl13-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 7794016..7794075 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6104196..6104255 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 32407697..32407756 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21248191..21248250 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 16932007..16932066 60
NO GENE  


Sequence tag IST10914E9HMR1
Sequence
CTGGAACTCACTCTGTAGACNNGGCTGGCCTCAAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAG
GCATGCGCCACCACCGCCCAGCTTTTCGAGACAGGGTTTCTCTGTGTAGCCTGGGCTGTCCTGGAACTCACTTTGTANAC
CATGCTGGCCTGGAACTCANAAATCCGCCTGCCTCTGCCTCCTGANAGCTGGNATTAAAGGCGTGCGCCACCACGCCCGG
CTAANGTAAATTTTTATATTATANTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 80764492..80764757 248
NO GENE  

 
Come back to gene ENSMUSG00000046792


For any suggestions or comments, please send an email to unitrap@crg.es