Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14289B6
Clone ID IST14289B6
Vector VICTR74
Project tigm

Sequence tag IST14289B6BBF1
Sequence
GTTTGAATATTTGCTACTACCACCAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14289B6HMR1
Sequence
CCACAAATTCACTGTGTTCCCTCAGTGAAATTCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI18390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64020247..64020283 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es