Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13501A12
Clone ID IST13501A12
Vector VICTR74
Project tigm

Sequence tag IST13501A12HMF1
Sequence
GGGTTTCTCTGTGTAGCCCTGGCTGTCCTAGAGCTCACTTTGTANACCAGGCTGGCCTCGAT
Sequence Type genomic DNA
Unitrap ID UNI15792 UNI36647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90702759..90702819 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027282 (Mtch2) NM_019758 mitochondrial carrier homolog 2 (C. elegans) Gene [Source:MGI (curated);Acc:Mtch2-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108405338..108405398 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029270 (2900024C23Rik) NM_026062 RIKEN cDNA 2900024C23 gene Gene [Source:MGI Symbol;Acc:MGI:1914516]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78331357..78331417 59
NO GENE  

 
Come back to gene ENSMUSG00000029270


For any suggestions or comments, please send an email to unitrap@crg.es