Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST431602
Clone ID OST431602
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST431602
Sequence
CATCTTTTTGGAGCTTTTTGCTTGGGGACTACTGACAGGACCCACATTGGTGGCANCGNATGAAACCTTNCNTAAACATA
CATTTCTGATGAATGGCCTAATTCAAGGAGTAAAGGGTTTGCAGTCATTCCTCAGNGCCCCACTTATTGGAGCTCTC
Sequence Type mRNA
Unitrap ID UNI1597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116350787..116354373 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027958 (Hiat1) NM_008246 hippocampus abundant gene transcript 1 Gene [Source:MGI (curated);Acc:Hiat1-001]

 
Come back to gene ENSMUSG00000027958


For any suggestions or comments, please send an email to unitrap@crg.es