Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14843C3
Clone ID IST14843C3
Vector VICTR76
Project tigm

Sequence tag IST14843C3HMF1
Sequence
AGAACCACTGATCTGACCTTGGTATTATGCTATAGTCCTTTCTTTGGTTTTTTGAACAGGACCTTGCTACGTAGTACAGG
CTGGA
Sequence Type genomic DNA
Unitrap ID UNI35863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27202956..27203039 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]


Sequence tag IST14843C3BBF1
Sequence
AGAACCACTGATCTGACCTTGGTATTATGCTATAGTCCTTTCTTTGGTTTTTTGAACAGGACCTTGCTACGTAGTACAGG
CTGGCCAGAAACTCACTTTGAAGTCCAGAGTTACTAAGAATCTTTTCAGGAAGAGATAAAAGCAACATCTATCCTTTTAT
TAAACTCCCAGTGACAAGCAAGAGGCATAATTCCACCAAAGTTCACAGGAACCANTGAGTCTATTGGGCTTCCTTTCANA
GCATAGGAAGGGCATTGTTAAAGAGATGTGGGTGGTTCTCCCCTN
Sequence Type genomic DNA
Unitrap ID UNI35863

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27202756..27203039 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es