Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13941H8
Clone ID IST13941H8
Vector VICTR74
Project tigm

Sequence tag IST13941H8HMF1
Sequence
GTGTTCTCTTGANCNNTACTCTGTATTCTAATTAANAAGTCTCAGGCTTACTCTCTCTTGTTCTTTCGCCTCTCGTTTTC
TTACTCTCTTTCCTCTTGCCCCCTTGCTCCCCTCTCTCCTCATCCCCTTCTCCCCTCTCTCCACGTGGTCATGGCCTGCC
TCTGCTTCTCTAGTCTCTCCTTCTCTCTGCNTTTCCCTGCCTCTACTACTCTCTTAACTCCCA
Sequence Type genomic DNA
Unitrap ID UNI36648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3055734..3055955 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023764 (Sfi1) NM_030207 Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI (curated);Acc:Sfi1-001]

 
Come back to gene ENSMUSG00000023764


For any suggestions or comments, please send an email to unitrap@crg.es