Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11562C8
Clone ID IST11562C8
Vector VICTR76
Project tigm

Sequence tag IST11562C8BBF1
Sequence
NCGCACACCTTTAATCCCTGCACTCGGGAGGAAGAGGCAGATGGNCTTCTGAGTTCCAGCACANCCAGGGCTATACAGAG
ATACAGAGAAACCCTGTCTTGAAAAACTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20455404..20455512 105
NO GENE  


Sequence tag IST11562C8HMR1
Sequence
NANGGAGAGAAAGAACTGAGGCNCAGGTTGTCCTCTGACCTCCAGGGCACACCAAAGAATGTACCCAGTGCCTCCTGCAC
TTGTACCCTATTTTTAAAATCTAGCCATTTGTTTGTTTGTTTGCTTTGGAGGCAGTCCCTCTGTGTAGTCCTGGTTGTTC
TGCANTCTATGTANATGANGCTGGCCTAAAAG
Sequence Type genomic DNA
Unitrap ID UNI16784

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64646441..64646630 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029174 (Tbc1d1) NM_019636 TBC1 domain family, member 1 Gene [Source:MGI (curated);Acc:Tbc1d1-002]

 
Come back to gene ENSMUSG00000029174


For any suggestions or comments, please send an email to unitrap@crg.es