Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12838G3
Clone ID IST12838G3
Vector VICTR76
Project tigm

Sequence tag IST12838G3HMF1
Sequence
GTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAATGAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGAC
AGCTACAGTGTACTTACATATAATAAATAAATCTTAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30247

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49100734..49100864 131
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 45931983..45932113 131
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73047997..73048127 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055553 (2810422J05Rik) NM_019883 RIKEN cDNA 2810422J05 gene Gene [Source:MGI Symbol;Acc:MGI:1922870]


Sequence tag IST12838G3HMR1
Sequence
ACCNGGAATGAGACTGCTCCAGCCCGGGGGAGAGAGAACCATCGGGTGAGGCAGGGCAGGAAAGCCCANANCTCCTGAAC
AGAATGCANAGTTGGGGACAAAGGACACAGCGGACACCTAGGAAGCTGGCTGATTCTGACTGTGTCTTTTAATAGCTGAG
GTGCTGGGTAACCGGCTCCCCAGTANGCTCCCCTGGGCCTTGGACNATGTTTGGCAGTGCTGGGTTATTTTNANCTCTCC
GGCN
Sequence Type genomic DNA
Unitrap ID UNI32595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144003282..144003524 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074758 (EG433481) predicted gene, EG433481 Gene [Source:MGI Symbol;Acc:MGI:3645019]

 
Come back to gene ENSMUSG00000074758


For any suggestions or comments, please send an email to unitrap@crg.es