Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10931G1
Clone ID IST10931G1
Vector VICTR76
Project tigm

Sequence tag IST10931G1HMF1
Sequence
GCTACCAGACTGCTCCTTGAATCAGTATCATAAACCCATCATCACCTGTGAGAAAGTCACTGAATAGAAACCTATACAGC
AGTGAAATAAATCTATGCTCATACACAATAAATACTATGGACTGCCTAANTACAAAGATGAATGAATAAAANAAGACTGG
GGCTGGNNAGATGGCTCANTGGTTAAGAGTGCANACTGCTCTTTTANAGGTCCTGAGTTCAATTCCCAGCAACCACATGG
TGGCTCACAACCNCCTATAATGTGGTCTGACACCCTCTTCTGGTGAGTCTGAAGTCAATGACAGTGTACTCATTACAATA
AATAAATAAATAAATCTTAAAAGAAGATAANATCNAGANGCTATCCAGTATGATTCCACAAAACATAATGTACNNGGCAA
GAGAGAATCTGGGGTTCTGGTCTCCATGATATGTTTGGGTTACACATACNTACTCACACTCANTCNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123427314..123427780 432
 
EST/CDNA Est Name
  AV086717.1 - CF741278.1 - BQ444308.1 - BI653941.1 - CD347889.1 - BP761489.1 - BY013291.1


Sequence tag IST10931G1BBF1
Sequence
GCTACCAGACTGCTCCTTGAATCAGTATCATAAACCCATCATCACCTGTGAGAAAGTCACTGAATAGAAACCTATACAGC
AGTGAAATAAATCTATGCTCATACACAATAAATACTATGGACTGCCTAAGTACAAAGATGAATGAATAAAAGAAGACTGG
GGCTGGAGAGATGGCTCAGTGGTTAAGAGTGCANACTGCTCTTTTANAGGTCCTGAGTTCAATTCCCANCAACCACATGG
TGGCTCACAACCNCCTATAATGTGGTCTGACACCCTCTTCTGGTGAGTCTGAAGTCAATGACAGTGTACTCATTACAATA
ANTAAATAAATAAATCTTAAAAGAAGATAANATCNAGANGCTATCCAGTATGATTCCACAAACATAATGTACCANGCAAG
ANANAATCTGGGGTTCTGGTCTCNATGATATGNNNGGGTTACACATACATNCTCACACTCAGTCNACACTATCTAGTTTT
N

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123427314..123427793 446
 
EST/CDNA Est Name
  AV086717.1 - CK633728.1 - CF741278.1 - BQ444308.1 - BI653941.1 - CD347889.1 - BP761489.1 - BY013291.1


Sequence tag IST10931G1HMR1
Sequence
NCTGCTANGNNAAANGCNANGTGTGGTGGCACATGCTTACAGTCCTAGCGTTTGAAGCCTGTGGGACTGCAGCAGTGTGT
TGGTTTCAGTGCTGTTGTTCTGGTTTTAGTGGTCCCCTCCCCAACAGCCAGTGTTTTTCATCCTCCTTTCANCCAGGCTA
ACACAGGTATGCAAGGCTTTGAACTTGGAATTCCACTGCCTTANTCTCCCAATTGTANACATGTGTCTCCGTGCCCTGCA
CAGTTTTAAAAATCCCTTGCNTN
Sequence Type genomic DNA
Unitrap ID UNI17114

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123427056..123427314 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]

 
Come back to gene ENSMUSG00000029475


For any suggestions or comments, please send an email to unitrap@crg.es