Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14339D2
Clone ID IST14339D2
Vector VICTR74
Project tigm

Sequence tag IST14339D2BBF1
Sequence
ATGCTAAATTTATCATTTTTTGTATGGTGGAAATATTTAATTAGAAAACTCTACTCTTTTGGTAGTGAAAAGAAATTTAA
AATAAAGTATTTCCTCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88748279..88748381 103
NO GENE  


Sequence tag IST14339D2HMR1
Sequence
ATGTGGTATAAAGATAATAATAGCCCTCATGGTATGAAATGATAACCAGTGTAATACGGTCTGATTAGGGACGGCGGCCC
ANNGGCTCACCTGTTTGAACACTCGCTCCTCANGTGATGGTGCTGATTTTGGGGTGGNGN
Sequence Type genomic DNA
Unitrap ID UNI18298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88748144..88748280 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068921 (Dap3) NM_022994 death associated protein 3 Gene [Source:MGI (curated);Acc:Dap3-001]

 
Come back to gene ENSMUSG00000068921


For any suggestions or comments, please send an email to unitrap@crg.es