Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14384C7
Clone ID IST14384C7
Vector VICTR74
Project tigm

Sequence tag IST14384C7HMF2
Sequence
TNNNTACGGGTCGCCTTTAAACGTTTCAAAGTTGTCGCAGGACGCAGCCGCATTAGGGAAAAACGTGGCTGCCCATTAAA
TCCGAAACCACCCCGTTCCCCCGGCCCGCTCTCGGCAAAACGTTACCCTCCAAAGCGACGGAGCACCCAAACTTACCTCT
AAACGAACCCCAGAATGGCGGCCGCCCGCTCGGGCGGAGTCTTTTATACCCGGCCACCGCCCAACGCACCCTAACGTGAT
GGAGAACCGCCCTCGCCGGGACACATTGTGCGCGAGGCGAACTCTGATTGGCCAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36053811..36054102 292
 
EST/CDNA Est Name
  BY444918.1


Sequence tag IST14384C7BBF1
Sequence
CCAGGGCTACACAGANAAACCCTGTCTCGAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI2350 UNI30897 UNI31178

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166280: 76233..76278 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079800 (A530040E14Rik) RIKEN cDNA A530040E14 gene Gene [Source:MGI Symbol;Acc:MGI:3612703]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5063997..5064042 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6292506..6292551 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5453353..5453398 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8798211..8798256 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 10995439..10995484 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047497 (Adamts12) NM_175501 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12 Gene [Source:MGI Symbol;Acc:MGI:2146046]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63387196..63387241 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021458 (2010111I01Rik) NM_028079 RIKEN cDNA 2010111I01 gene Gene [Source:MGI Symbol;Acc:MGI:1919311]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3584147..3584192 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3100989..3101034 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53174105..53174150 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 23228437..23228482 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11492522..11492567 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 8390072..8390117 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29156663..29156708 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3223980..3224025 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4190059..4190104 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33050031..33050076 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 32569777..32569822 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7577124..7577169 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5011712..5011757 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 26457785..26457830 44
NO GENE  


Sequence tag IST14384C7HMR1
Sequence
NNNGATTACACCTTCCTCCTTTTGTGTTCCTTTTACCCCAGGTTGAATTTTCTCGGAGAAAGACAGGCCGGCCATCAGGA
AAACAAACAAGCCTCANCAACATCTAAACCCTTGAAAGGATCCTGAGAGGGGGGAAAGGGAAATCAGCCACCAGCCCAAC
CACTCGTGTCTTCTGCCCCTCCCCACCTATCTTGCCCACCCNACCN
Sequence Type genomic DNA
Unitrap ID UNI2151

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36054105..36054306 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039220 (Ppp1r10) NP_787948 protein phosphatase 1, regulatory subunit 10 Gene [Source:MGI (curated);Acc:Ppp1r10-001]

 
Come back to gene ENSMUSG00000039220


For any suggestions or comments, please send an email to unitrap@crg.es