Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12718A12
Clone ID IST12718A12
Vector VICTR76
Project tigm

Sequence tag IST12718A12HMF1
Sequence
GTCACAATTCCATACTGTAGAGAATAAATGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI13711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45600472..45600506 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es