Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13220F4
Clone ID IST13220F4
Vector VICTR74
Project tigm

Sequence tag IST13220F4HMR1
Sequence
GAGNCAAGCAGGAGGGTGCATGCCAGGAAGTGCCCACAGGAGACCCAGCTGAGCCAGGGGCCAAAAGAATTCGCCTGGAA
GATGGGCAGGAAAATGGGAAGACAGAGGTGGCAATTGAATCCCGTGAAAGGCAGGTGCCCAAGAGGGCCCGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI26433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56904989..56905144 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007603 (Dus3l) NM_144858 dihydrouridine synthase 3-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147092]

 
Come back to gene ENSMUSG00000007603


For any suggestions or comments, please send an email to unitrap@crg.es