Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10722G6
Clone ID IST10722G6
Vector VICTR76
Project tigm

Sequence tag IST10722G6HMF1
Sequence
GGGCCTTCTGCTCTTTTTCCTGCTTATGTGGTCACTTTCCCAATAACTTCTGGTAAGTAGTCCTCTGCTCAAACTCTGCC
TCTGTGAGAGCGTCCATGGTCTCCCCAGCTCTGGTATGGA
Sequence Type genomic DNA
Unitrap ID UNI31376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3456703..3456821 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023800 (Tiam2) NM_011878 T-cell lymphoma invasion and metastasis 2 Gene [Source:MGI Symbol;Acc:MGI:1344338]

 
Come back to gene ENSMUSG00000023800


For any suggestions or comments, please send an email to unitrap@crg.es