Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0247
Clone ID AG0247
Vector pGT0lxr
Project sanger

Sequence tag AG0247
Sequence
GGTTGTGAGCTCTTCTAGATGGTTTTAACTTCTTAGCAATGGACGGAGGCCACGGCGGTATGTGGTCGCGAATGAACCGC
GCGGCGGAGGAGTTTTATGCTCGTCTCCGGCAGGAATTTAATGAAGAGAAGAAAGGAGCCTCTAAAGACCCATTCATCTA
TGAG
Sequence Type mRNA
Unitrap ID UNI3467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64016420..64020713 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032400 (Zwilch) NM_026507 Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI (curated);Acc:Zwilch-001]

 
Come back to gene ENSMUSG00000032400


For any suggestions or comments, please send an email to unitrap@crg.es