Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15092B8
Clone ID IST15092B8
Vector VICTR80
Project tigm

Sequence tag IST15092B8BBF1
Sequence
CACTGTTGCCACTGGAGGCCCGGGAGAAGAAGATGCCCAGCTGGTTGCCATTTTCCAGGTGGCACTTGATCTCCAGCAGC
TCCCGGTAGCGTTCATACTCCTCATCAGTGAGCCCAGGTAGGTCAGCCCCTCCCAGCCCTGCCCCCTCAGCTAACAGAGA
ATCCATGCTGAAGTGGAAGTCCCTGCTCTGTAGGGCATCCCCTTGTAGACCAAATTTGCGTAGGCTTCCAGGAGTGTTGG
TGGTGCTGGGAGGTTCATCCCCCAGCAGGTCATGTTCANAGCTCTCTTCATTGCGGGTACTCTCATCAGTCCGACCCACC
CNGCTGTCCANGTCCTGGNTGNTGTTTAAGCCTGGGCCCCCNTCANGAGCCCNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71040869..71041240 358
 
EST/CDNA Est Name
  BB448215.2


Sequence tag IST15092B8HMF2
Sequence
CACTGTTGCCACTGGAGGCCCGGGAGAAGAAGATGCCCAGCTGGTTGCCATTTTCCAGGTGGCACTTGATCTCCAGCAGC
TCCCGGTAGCGTTCATACTCCTCATCAGTGAGCCCAGGTAGGTCAGCCCCTCCCAGCCCTGCCCCCTCAGCTAACAGAGA
ATCCATGCTGAAGTGGAAGTCCCTGCTCTGTAGGGCATCCCCTTGTAGACCAAATTTGCGTAGGCTTCCAGGAGTGTTGG
TGGTGCTGGGAGGTTCATCCCCCAGCAGGTCATGTTCAGAGCTCTCTTCATTGCGGGTACTCTCATCAGTCCGACCCACC
CCGCTGTCCAGGTCCTGGCTGTTGTTTAAGCCTGGGCCCCCATCAGGAGCCCCCTTCTCATCATTTCCAATCTGGGACAG
AAATGACAAACATACTCAGTTAGGTTCTCACAGACAAGTGTGCNGCAGAAGGACTAGAAAGTTCNCANCTTGCTCCTCTC
NAGGCCCATGCTGGAAGANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71040869..71041366 490
 
EST/CDNA Est Name
  BB448215.2 - BM950645.1


Sequence tag IST15092B8HMR1
Sequence
CTACNNAGTGAGACTCTGTCTCAAAATAAAAACAAATCATAACAAGGAAACAAAAATACCTCATTATCGTTTTANCTTGC
ATTTCCCTAAGAGCTCAGGGTGCTTGCTGGTGATGCTTTTGTGTTTCTTTCCTGCCGGCAGGCCTTTGATGAAGAGTGTT
CACACCTTTTACTTCTAAAATACTCANTTC
Sequence Type genomic DNA
Unitrap ID UNI16388

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 110024714..110024902 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es