Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14883F11
Clone ID IST14883F11
Vector VICTR76
Project tigm

Sequence tag IST14883F11HMR1
Sequence
NAGGCAGGCAGATCTCAGTGAATTTGAGGCCNACCTGGTCTCCAGAGAGTATTCCAGGACAGCCATGGATACACAGATAA
ACTCTGTTTCAAAAACAAAAAACTACCAGCTGGTATTTGGCAATTATCAACTAATGAACCATACATTACCGATATATACT
AATAAGACAACNTAAACCTATTTTGCATTTTACAAACCCAAACAATTCTAATTTCTATATTAATAAGTTAAAAAACTTGT
AAAAGCAGTAATATAAAATATCTCTTTTCNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043245..92043515 265
NO GENE  


Sequence tag IST14883F11HMF1
Sequence
CCTCTACCTCTCAAGTGCTGAGATTGAAGGCATGTGCCAACACAACCCGTATTGAATTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI14434

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92043513..92043576 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es