Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12543G12
Clone ID IST12543G12
Vector VICTR76
Project tigm

Sequence tag IST12543G12BBF1
Sequence
CCAGGAACCAGACTCANNNNNATAACATGTGCAGCAAGCTGTTTTTACCTACTGAGCCATCTCACAGTCCAGTCACAACA
GTACCCAGTTTACTTCATGAAACTGTGTTCTGAGCGCTANAGCTGGTGTGTTTGTTTATTTGTTTGTTTTGTCATTGTTG
GTTTTTGTTTTTTGTTTTTGTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI25742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76323400..76323589 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]

 
Come back to gene ENSMUSG00000048490


For any suggestions or comments, please send an email to unitrap@crg.es