Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11625F4
Clone ID IST11625F4
Vector VICTR76
Project tigm

Sequence tag IST11625F4BBF1
Sequence
TTCCGAAGGTCCGGAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI32439 UNI36419 UNI36579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 8480178..8480245 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 35954737..35954804 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5284068..5284135 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 102154431..102154498 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 46837150..46837217 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35504618..35504685 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 63037143..63037210 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22350786..22350853 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 34761500..34761567 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 39387571..39387638 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036452 (Arhgap26) NM_175164 Rho GTPase activating protein 26 Gene [Source:MGI (curated);Acc:Arhgap26-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5574201..5574268 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 24709832..24709899 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 15878501..15878568 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10877202..10877269 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34416693..34416760 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38404449..38404516 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038538 (D130059P03Rik) NM_177185 RIKEN cDNA D130059P03 gene Gene [Source:MGI Symbol;Acc:MGI:2444236]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16424055..16424122 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60213182..60213249 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53266325..53266392 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 363640..363707 66
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5755418..5755485 66
NO GENE  


Sequence tag IST11625F4HMF1
Sequence
GCTCTCCTTTACCGCTTGCATATACACTTGCTATTCCCTTAACTGGAGTGCGCTCCTGCCCTGCAGGCTCTTCACCCTGA
TCCCCCGCTCAGTCTCTATTTAGTATTCTCCTGATCCTTCTTGAAGACCAAATCCTGGGCTTTTCCCTCTGGGAAGTCTT
CTCCCTAGTCATCAGTGAGCCCTTCTTTCCACCAAACAGGCTTTTCACTTTCCCTGGGCCCTGTCANAGCANATGGAACA
GGTCATAATANGTCAGGATTTTCTCTCCCANCCTTCTTTGTGGGTCTCANACAGTGGGTTCTGAGGGATGGTCTCCATCC
TGCACCCTTCCTANACTGAATCCCGGTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117041258..117041610 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es