Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST431278
Clone ID OST431278
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST431278
Sequence
TGAGATTGATCCAAATCCTGATNAGTCATCCGAGGNCAGACCATCATGCCCCTCTCGCTGAAGCAACACTTGACTGAGTC
AAGTTGACATGGGTTCTGAACTGTATCTCTTCCAGCTGAGGACAGAGAAGTATCTTGGAGACACGTTTGCAGAGGAAGTG
GAATTGCCTTTGCCCAGACAGATGGCAAACACATGAAACAACCAGTGATCATGCTTTAGAATCCTACAGCATCATTTGGG
GCTGTTCCAACATGCTTGAAGATCTGAGCTTTCCTCCTTTAAAACTGGCACATGTTAAGGGCAGTCTTCTTAGCCTGTGG
TCATCCGTGTCAAGACACCATTGCAAAGAAGGATGTTGTCCTTCCTATTTGAAAATTTGCACATGCTCAATGCTTACATT
GTGCAGTTCAGTGTCACTACAGCATTTTTTTTCCATTTATGCCAGACTCTTGATACTCTTACAACTTGTTTATGGTCAGC
ACAACATGGAACAAAAGAAAGCTTTG
Sequence Type mRNA
Unitrap ID UNI18053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81032629..81033132 498
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074794 (Arrdc3) NM_001042591 arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]

 
Come back to gene ENSMUSG00000074794


For any suggestions or comments, please send an email to unitrap@crg.es