Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12286D3
Clone ID IST12286D3
Vector VICTR76
Project tigm

Sequence tag IST12286D3BBF1
Sequence
CCTCGAGGACCCGACCTTTGGCAAACCCTACGCTGCATTCACAATGGCAGCTGAGCCACATGTTTTTGATCTGGCAGCAA
CTGGCAGCTGAGCCACATGTTTTTGATCTGGCAGCAACTGAGACCTCGTCTTTCTGGACTTCACAACATTCTACCACTTA
GCTCATGATTAGACAGGCCTGCATCAGACTCATGCACTAATACCTACAGAGGAGGTCTGCCCAGAGCGTCTCAGAACTGT
TTAATTGGTCAGAAAGGGCTTCCATTGTGAAGGGCCTTATCTGAGCCCGAGACTGAGAAAAACCGGGAGACATGAGGCAC
CGCGGGGCTGGGCAGACAGTGAGCCTGTGGACATGGTTCTGAGCTCTCCCGTTTAACGGGGACCCAGGGAGGGCAGGTGC
CTTCCAGGCTGCTGTCAGGATTTCTCAGTGGANTCGGANTGGGGAGCACTACCTGGGANAAGACTCCCCCGTGANGAGTC
NNGGAGCACCTTCACCTANNCATTGACTCCTATTCTCCCTGANCTCCNGGGGCCCANNNTCCTGACTGAANTNNNNCTTT
TCCTANAGNCNNCCTTGANCCTGNTGTCNTGGTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12286D3HMF1
Sequence
CCTCGAGGACCCGACCTTTGGCAAACCCTACGCTGCATTCACAATGGCAGCTGAGCCACATGTTTTTGATCTGGCAGCAA
CTGGCAGCTGAGCCACATGTTTTTGATCTGGCAGCAACTGAGACCTCGTCTTTCTGGACTTCACAACATTCTACCACTTA
GCTCATGATTAGACAGGCCTGCATCAGACTCATGCACTAATACCTACAGAGGAGGTCTGCCCAGAGCGTCTCANAACTGT
TTAATTGGTCAGAAAGGGCTTCCATTGTC
Sequence Type genomic DNA
Unitrap ID UNI14303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107643653..107643920 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033685 (Ucp2) NM_011671 uncoupling protein 2 (mitochondrial, proton carrier) Gene [Source:MGI (curated);Acc:Ucp2-001]

 
Come back to gene ENSMUSG00000033685


For any suggestions or comments, please send an email to unitrap@crg.es