Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14231B2
Clone ID IST14231B2
Vector VICTR74
Project tigm

Sequence tag IST14231B2HMF1
Sequence
CACTGATACAGACTCTAGACCTGTGCTGTCAAATTGAATGATTATATACAATGAAATTAAGATGAAACAAATTAAAACTC
ANGTTTTTGGTAATCATACTACATTTCTTTGATAACCATATTTTAAGTGCGCCAAAAATGACTGCTAATAGATACCATGT
TGGACAGTGCAGATATAGAATATTATTATCACAGAAAATTCTATTGGAAACGCTTGTTCGATCCAGTATCTAGAATCAGT
ACCTTCTCGTATTCTCAGCATCAAACACATCATTTATATCACCATCCCAAACATTTTACTCCATTTACATCTATCAACTT
GTAAAGGTTTCCAGCCATTCACATAGTCNAGAAGTACACTGCTTGAACCTAACCTTTAATGACCNAATACCTTACGATAT
ATTTCCTTCCATATTTATAAATCATCTCTCCAACAATCTGACCNATGAAATGCCATCCCCATGAAGTCTACTTTAGCNCA
AGACAATGAACCTATGANANATACANGGGACTCAACGGAACCNATTTAACTGAAATGAAAACNAACGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118873915..118874464 530
NO GENE  


Sequence tag IST14231B2HMR1
Sequence
AGTGGAGTCTGAATCAGTGAAAATGTTTGTATATTTTGGTTGTATAAATTCAGGAATGGACAAAGAGCCAGATAGTATTT
AGGCTCTGCTTGCTG
Sequence Type genomic DNA
Unitrap ID UNI15836

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118874461..118874555 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027326 (Casc5) NM_029617 cancer susceptibility candidate 5 Gene [Source:MGI (curated);Acc:Casc5-004]

 
Come back to gene ENSMUSG00000027326


For any suggestions or comments, please send an email to unitrap@crg.es