Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14551E2
Clone ID IST14551E2
Vector VICTR74
Project tigm

Sequence tag IST14551E2HMF2
Sequence
NTAACANGAAGCTGGCTGATCCTCCAGCGACCCACTTCCTCTANCTAGGCCTACAGTTGTAAAATTACCACAATCTCCTG
AAACAGCCCTGCCAGCTGGAGAGCAAGTATTCAGGTACGGAAGCCTGTAGGGACTACCCAGAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_112000: 156197..156341 141
NO GENE  


Sequence tag IST14551E2HMR1
Sequence
NNNNTACATATAATAATAAATAAATCTTTAAAAAATTCATAATAAATGAAAAATATAACCNGTCTTCTTGGAACTCCTTT
CCAGTAACTCAGACTGAAGACTAAGCTAGCTGCAAAGTTACAGTGATCCACCTCCCTCTGCCACCACCACCACCACCACT
GCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14551E2BBF1
Sequence
NGNNCACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI4639 UNI12836 UNI31310 UNI32988 UNI32989 UNI32990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6988161..6988204 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7388920..7388963 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6509689..6509732 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3520439..3520482 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12405565..12405608 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052374 (Actn2) NM_033268 actinin alpha 2 Gene [Source:MGI (curated);Acc:Actn2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14648997..14649040 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5199914..5199957 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4805980..4806023 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3300596..3300639 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 5350876..5350919 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3566165..3566208 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024908 (Saps3) NM_029456 SAPS domain family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1921807]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4815597..4815640 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8960364..8960407 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027506 (Tpd52) NM_001025261 tumor protein D52 Gene [Source:MGI (curated);Acc:Tpd52-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4557837..4557880 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5050175..5050218 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028926 (Pftk1) NM_011074 PFTAIRE protein kinase 1 Gene [Source:MGI (curated);Acc:Pftk1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29222232..29222275 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6339200..6339243 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11577094..11577137 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3250015..3250058 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2062..2105 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 158107..158150 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069661 (AC140325.3-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7584798..7584841 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031163 (Glod5) NM_027227 glyoxalase domain containing 5 Gene [Source:MGI (curated);Acc:Glod5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144675..144718 44
NO GENE  

 
Come back to gene ENSMUSG00000031163


For any suggestions or comments, please send an email to unitrap@crg.es