Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14923G9
Clone ID IST14923G9
Vector VICTR76
Project tigm

Sequence tag IST14923G9BBF1
Sequence
GGCACAAGCTGGAGTCATCTGAGGATGACTGAGGGAGCTTCAATTGAGAAAATGCCTCACAGAGAACCCAGCTGTAAGCC
AACAAAGCGGTAGAACGTTTTCTTAATTAGTGATCTGGGGGTAGGGGTAACCCACTGTGAGCGGTGCCATCCCTGGCCTG
GTGCTCCTGGGTGCTGTAANAAANCNNGTCGAGCAAGCTGTGGGAGAGCAAGCCTCATCATCCTTGGCCTCTGCATCAGC
TCCTGCCTCCAGGTTCCAGTCNGGTTTGTGTTCCTGCCNNGGCNNCNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106987831..106988113 269
 
EST/CDNA Est Name
  CA571280.1 - CA571560.1 - BE852294.1


Sequence tag IST14923G9HMF1
Sequence
GGCACAAGCTGAANTCCNTCNNNANNNNNNNNNNNCNGGNCNNNNNGNNNNNNGCTTNNNTANNNAACCCAGCTGTAAGC
CAACAAAGCGGTAGAACGTTTTCTTAATTAGTGATCTGGGGGTAGGGGTAACCCACTGTGAGCGGTGCCATCCCTGGCCT
GGTGCTCCTGGGTGCTGTAAGAAAGCAAGTCGAGCAANCTGTGGGANAGCAAGCCTCATCATCCTTGGCCTCTGCATCAC
CTCCTGCCTCCAGGTTCCAGTCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106987895..106988092 192
 
EST/CDNA Est Name
  BE852294.1


Sequence tag IST14923G9HMR1
Sequence
NGCCNNGANACATCAAACTAACTAGCACATAGGTAGTATTAAAGTCACAGACATAAAACTAACTC
Sequence Type genomic DNA
Unitrap ID UNI18463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106987770..106987827 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es