Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14167F1
Clone ID IST14167F1
Vector VICTR74
Project tigm

Sequence tag IST14167F1BBF1
Sequence
ATCNACACGGGGGATGANCNNNNACTNGNNTGTGTGCCNCCNCATACAAGGTTCACAGGGGAGTTGCAGGACCACAGAAA
TGGGCAAACAGGAAGGGCAGACATCTTTTTCTTTGCTTCTCTGGTCAGTGAAGCCTGGTGCCACTGCCCCTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14167F1HMR1
Sequence
CTTTTCCCTTTGAAAAGTAATTCTAGCTTANATGGGTTGGAATTTTTTGTAAGGCAGTAACTATTTAATAAAGCTTGTAT
ATGAATTTTAATGTTTTTGAATGTAAACTACTCCCGACTAAGGAAACAACAGTTATTTATTTATGTACACTATCACTGTC
TTCGGATGCACCAAAAGAGGCGGTTGGATCCCATTACAGCCGGTTGCTGGGAGTTGAACTCANGACCTCTGGAAGAGTGA
GCAGAAAGTGCTCTTAACCCCTGANCCATCTCACC
Sequence Type genomic DNA
Unitrap ID UNI34125

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79889411..79889684 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]

 
Come back to gene ENSMUSG00000036461


For any suggestions or comments, please send an email to unitrap@crg.es