Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST431155
Clone ID OST431155
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST431155
Sequence
GATTGAGAGATCCCGAGGATCATCCAGCTGGNCCTTGACCTGAAGTATAAGACCAACATCCGAGAGTTGTTTGAGGAGTT
CGACAACTTTCTGCCAGGCGCTGTTATCGGCATAGCCAGAGAGATGCAGCCTGTGTACAGGTCTCTTCTCCACAAGAGTT
GGCAGTGGCCCTGGTGCATGCTTCAGGGAGCCTGGTAACAAGAACACTTGAGGATGTACCCAGCAGAGTGACCCGTCCCT
GCAAGCACTTTGGGTGCCTCACCCAGCACTGGCCAGTGAAGGAAGCAAGCAAGCCGTCCTCCACCACCAGCCAAGTTACC
TGATGCTTCATCTCCTGCCCCAGTCTTGTCATACCTTACCCTTCCTCCTATACTGGGGAGTCATCTGAAGCTAAAGGAAG
AGAGATTGCACCTAAAAGGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI10259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30969747..31007934 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047434 (AI480653) NP_941028 Uncharacterized protein C3orf21 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G3]

 
Come back to gene ENSMUSG00000047434


For any suggestions or comments, please send an email to unitrap@crg.es