Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13606E11
Clone ID IST13606E11
Vector VICTR74
Project tigm

Sequence tag IST13606E11HMR1
Sequence
CTATCAGTTTNNTTCTCCCATTGTTTTTTTNAAGTGTCCCACAAACTANCTGGAGAAAGAAGCTTCTGCTGTCTATCTGC
AGATTATCTAAAGGCTGGAGAACAAGATTTGTACACTGCATCTAAACATAGGAATTTTGACCCACCCTCCATCAAGAACA
AGCATAAACCCAGATGTGGTATAATCCCCCACACAAGAGGCTGAGAGGCAAGAAGATCCTGAGCTTGAGGTCAACCTTGG
AAACAGAGAGTTCGAGGAAATCTTGGGATGTGTAGTGAGACCCTGTCTTGTTTCAGAGACGGGCTGCATAAAACTCCATG
TTCAATCCTTAGTGCCNCCTAAACTGGATGTGGAGCTATGATCCCAGCATTCAAGAAGAAAAGGTAGGAAGACAAGAAGT
TTAAAGTCNTCCTCAACTAGATAGCAAACTTGAGACNNGCCTGGGATACACAAGANCCTTCCCACAGAAAGATGACAAGG
AAGAGATTCNTTTNNNGTGAACAANNTTAAAGTNTTTTTTTATTTGGNATTANTNGN
Sequence Type genomic DNA
Unitrap ID UNI30077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101391117..101391648 498
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046449 (C77370) NP_001070822 Uncharacterized protein KIAA2022 [Source:UniProtKB/Swiss-Prot;Acc:Q5DTT1]

 
Come back to gene ENSMUSG00000046449


For any suggestions or comments, please send an email to unitrap@crg.es