Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14778D8
Clone ID IST14778D8
Vector VICTR76
Project tigm

Sequence tag IST14778D8HMR1
Sequence
GCTCTTTAAGGACAGTCTTGGGCGGGTAAGAGCACTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCAACCACA
TGGTGGCTCACGACCACCCATAATGAGATCTGATGCCTTCTTCTAGTTTGTCTGAAGTCAGCTACAGCGAGCGGGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86712111..86712268 158
NO GENE  


Sequence tag IST14778D8HMF2
Sequence
GAGCTCACATAAGCACTCATATAAAAAGGAGACTTGGGCTGATGAGAGAAGGCTCGGTAGGTTAAAAAGCACTTGGCACC
ATGACTGATGTCCCGAGTTCCATCTTCAGAGGAAGGAGAGAAGTGACTCTTGCAAGGTGTCCTCTGAACACATACATATG
TGAGAAAAATGTTTGAAAAGTCTCACCATGTAACCTTGGCTTGCCTAGAACTTGCTTGCTATGTGACTAGGCTGGCTTCA
AACTCGAGGCTCATTTTGTCTTTGTCTCCAGAGTGCCAGAATTAAAGGAAATTGTAGAAAAGTCACAACAGCCATGTTTG
TAGCACAAGTGTGTGATCCCATCTTGGGGAAGTGGAGACAAAAGGACCTCTGGGGCTCTCAGGAAAGCCTAACAGGGGCC
CCANGTTTTACTGTGCTCAAAANCAAACTANTGGTAGATGTGGTACNAGCCTTCANTCCCAGCACTANANGTATACAGAC
CCCTGGCANANNGAACGANNNACTTATGCCCNNGCCCTGTTCANCTTANNNCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86711587..86712114 496
NO GENE  


Sequence tag IST14778D8BBF1
Sequence
TGTCTGCCGCATGCAAGGGATGTCTGAAGTCCATTTTGTGTATTTGTGGCCAACTTGGGCTGCTCCCTTTGAGGCACTAT
CTCCCACAGAACCAGGAGCTTGCTGAGTGGGTCAGATGGCTGTCCATGAGCTCCAGCAATCCCCCTGCCTCCGTCTCTCC
AGANCTAGGGATACGGATGCACACCACCACACTTGGGATTTTTACATGTGCTGGTGATTCAAAGGCAGGTTCTTGTGCTG
TGCATGCCCTTACTAATGGAGCCNTCTTCCAAGCCCTTAAGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGNTNNGNTNN
GN
Sequence Type genomic DNA
Unitrap ID UNI30895

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57013007..57013317 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es