Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST431073
Clone ID OST431073
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST431073
Sequence
GACTGAGCTTCCTGGAGCATCTGCACAAACACCAGGGCTCTGTCCTGCACCCCGATTACAAGACAGCCTTCCCCTCCTTT
GAGGACGCCCTCCATCGCCTCCTGCCCTACCATGTCTACCAAGGCGCCCTCCCCTCCCCCAACGACTACCATAAAGTGGA
TGAAGAATTTGAGACTGTCTCTACGCAGCTGCTCAAACGCACCCAGGCCATGCTCAATAAATATCGGCTTTTGCTTCTGG
AAGAGTCCAGGAGAGTCAGTCCTTCTGCGGAGATGGTTATGATCGACCGAATGTTCATTCAGGAGGAGAAGACCACCCTT
GCCTTGGATAAGCAGCTTGCCAAGGAGAAGCCTGATNCTNCCTGTCTGTCTTCTGAGAAGCCANGATGGCNGATGNNGAC
CACTACNCNCGGNTTGNGACTGCACTTTTTTAAAATANAATATTTATTTATTGTAAGACCACTACACCCGGCTTGGGACT
G
Sequence Type mRNA
Unitrap ID UNI18060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 16528425..16561164 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070808 (Gltscr1) NM_001081418 glioma tumor suppressor candidate region gene 1 Gene [Source:MGI Symbol;Acc:MGI:2154263]

 
Come back to gene ENSMUSG00000070808


For any suggestions or comments, please send an email to unitrap@crg.es