Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10607A4
Clone ID IST10607A4
Vector VICTR76
Project tigm

Sequence tag IST10607A4HMF1
Sequence
TCACAAGGCCCTGATTCCACTCCTGCTACCGTACACAANAGTGGATCGCAGCTGTTTATATGTTAATGTGACACTGGCAT
GTGTACCGTGTATAATGGA
Sequence Type genomic DNA
Unitrap ID UNI31094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89629227..89629324 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060961 (Slc4a4) NP_001129732 solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]

 
Come back to gene ENSMUSG00000060961


For any suggestions or comments, please send an email to unitrap@crg.es