Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11845F4
Clone ID IST11845F4
Vector VICTR76
Project tigm

Sequence tag IST11845F4HMF1
Sequence
GTGTGTAGCTTGTATTCCAATTAATTGAGTTGTGATTTCTTGAACTGGGCTTTTTTGGGGTTGGAGATTTACCCCAACAG
GTAACTGACATTTTCTCCTCATGACTCTGGTTACTAGAAGTCGAAGCACACATCATTACGTCTGGTGTGTCTTTGCTCTT
CTTTGGCTTACAGATGGACACCAACTCTGGTCCCCACGTGCTCTGTCTCTGTGTATGGCATCCGTTGTGTCTGTGTGTCC
ATATGCTTCTTATTANACTGGCTCATTTTAGCTTGATTGAAAGGCTCTGTCTCCAAATTAAGCCGCTGGGCATTAAGGTT
TCGACATATGTATTCANATTTCAACATATGAACACAATTCGGCCAAAATAACTCCTAGTTGAAGAATGCCTCCCCTCACC
CNNNGTCCNACCGACTGGCTCTCGANGCCCATCCCTGTTCGTCCNNTCNNANCATCTGCTATCCACTTANTGTANGANGC
TTTATTTGCCTTCCTGTGTCAGCCTCGNANCNNGTTTATANNGGCCCTGNNNTAN
Sequence Type genomic DNA
Unitrap ID UNI20699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38448529..38449057 487
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002844 (Adprh) NM_007414 ADP-ribosylarginine hydrolase Gene [Source:MGI Symbol;Acc:MGI:1098234]

 
Come back to gene ENSMUSG00000002844


For any suggestions or comments, please send an email to unitrap@crg.es