Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14666F4
Clone ID IST14666F4
Vector VICTR74
Project tigm

Sequence tag IST14666F4HMF1
Sequence
AAATAACTGGAAAAAAATATATATTCNCAACAGCAACAAAATCCTGAAATACCCAGAAATAAAGAGAAAACTAAAATGTC
AAAATTTCTATGGGAGAAATTTGGAGCTGCATAGATGATAAAAGGAAAAGACTGTAATCGAAAAGATCTACGCCATAAAG
AAACAAGGCTTTCTGGAAGTCGTGAATGCAATGCGCTTCTTACTACATCAGCAAAGATCTTAAACAAAGAGCTTCGGTCT
GAACCGACGGAGCGGACNAGACGCTCTGGTAGTGCAAAAGCCATGCAGCACTCACAACGGANCAAACGCCCAGAAATCAC
AGAGTGGAAAATCCCAAATCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120073233..120073575 337
NO GENE  


Sequence tag IST14666F4BBF1
Sequence
AATAACTGGAAAAAAATATATATTCACAACAGCAACAAAATCCTGAAATACCCAGAAATAAAGAGAAAACTAAAATGTCA
AAATTTCTATGGGAGAAATTTGGAGCTGCATAGATGATAAAAGGAAAAGACTGTAATCGAAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120073427..120073574 148
NO GENE  


Sequence tag IST14666F4HMR1
Sequence
ATTTTACCCCTAATACTTCATCTCTCTGGGTGTTTGCACACTTCATCTGTCTTTAAATCTTCTTTAAATTAGATTGGAAG
TCAGGCCACAGGGAAGGAAAGACTCCGCAAAGAGCCTTCCTTTTGAGCAGGGTCTCCTTGAGGGTGGGGTGGGGTGNNTN
NNCNGA
Sequence Type genomic DNA
Unitrap ID UNI16301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120073572..120073727 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032517 (Mobp) NM_008614 myelin-associated oligodendrocytic basic protein Gene [Source:MGI Symbol;Acc:MGI:108511]

 
Come back to gene ENSMUSG00000032517


For any suggestions or comments, please send an email to unitrap@crg.es