Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15097D2
Clone ID IST15097D2
Vector VICTR80
Project tigm

Sequence tag IST15097D2HMR1
Sequence
TTANGCNNNNNTGCNNNCACNCNCNCTTGTACACACACNCNNAGCACAANATANTTAAATAAAAAAATTTTTANTGCNNT
ACANNNTTTANANACCTCCTGANTCTTATATTAAGATTTTACTANGAATGGAATANAGGACCNCCTGCNTTTANCATTGG
GATTGAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15097D2HMF1
Sequence
CTGCAAGGCAATAAACAAAATCCCCTAAACTCCTAGTCAGGATGACCAAGACAAAAGAACTGCTATGCACTCTTCTGCTG
CTAGCTCTGAGCTTTGCCTTAACTCAAATGTAAATGTTTGTAATCTGAGCCTCTTTCCTGAGTCCCAGCTCACAGTCAGA
TTCCCACTTCTTTGTCCTGGGCCTTTGTCAAATTCCCATCCCCAAAAGCTCCCCACACATAAAGTATTTAAAAGTGTTTT
AATTAACATGTTTATTAAGATTATATTTTATTAACGTTTATTAATATCATATCTTGTTA
Sequence Type genomic DNA
Unitrap ID UNI7776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134807727..134808024 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es